ID: 900750510_900750521

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 900750510 900750521
Species Human (GRCh38) Human (GRCh38)
Location 1:4394027-4394049 1:4394069-4394091
Sequence CCACTCTGGTAGATGATGCTGAT ATGTGGGTATGGAGGGTACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 88, 4: 444} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!