ID: 900760025_900760037

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900760025 900760037
Species Human (GRCh38) Human (GRCh38)
Location 1:4464119-4464141 1:4464154-4464176
Sequence CCCTCCTTCCCTCCAACCCCACT TTGCCCCACCCCACAGTGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!