ID: 900762710_900762717

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 900762710 900762717
Species Human (GRCh38) Human (GRCh38)
Location 1:4483606-4483628 1:4483619-4483641
Sequence CCCCAAAGGCTGAGTCCAGGGCA GTCCAGGGCACTTCAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 265} {0: 1, 1: 0, 2: 1, 3: 16, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!