ID: 900762710_900762719

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 900762710 900762719
Species Human (GRCh38) Human (GRCh38)
Location 1:4483606-4483628 1:4483625-4483647
Sequence CCCCAAAGGCTGAGTCCAGGGCA GGCACTTCAGGAGGGGGAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 265} {0: 1, 1: 0, 2: 2, 3: 26, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!