ID: 900787646_900787657

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 900787646 900787657
Species Human (GRCh38) Human (GRCh38)
Location 1:4658770-4658792 1:4658823-4658845
Sequence CCTTTTCTTCCATGCATTGGAGA AGACAGCCCCACGCCTGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 238} {0: 1, 1: 0, 2: 1, 3: 19, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!