ID: 900790126_900790130

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900790126 900790130
Species Human (GRCh38) Human (GRCh38)
Location 1:4674519-4674541 1:4674543-4674565
Sequence CCTGCTTTAGGTTCAGAGGTCAG GCAGAAGCAGAAATACGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127} {0: 1, 1: 0, 2: 0, 3: 26, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!