ID: 900794709_900794711

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900794709 900794711
Species Human (GRCh38) Human (GRCh38)
Location 1:4700928-4700950 1:4700955-4700977
Sequence CCAGCAGCAGAGGCTCAGCTAAG AGAGCCAGGTTTCCCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 226} {0: 1, 1: 0, 2: 3, 3: 26, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!