ID: 900796752_900796755

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900796752 900796755
Species Human (GRCh38) Human (GRCh38)
Location 1:4712640-4712662 1:4712658-4712680
Sequence CCAGTCCCAGCAACAACGGGGAA GGGAAGTCACCCAGCCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125} {0: 1, 1: 0, 2: 6, 3: 39, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!