ID: 900806573_900806584

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 900806573 900806584
Species Human (GRCh38) Human (GRCh38)
Location 1:4771524-4771546 1:4771552-4771574
Sequence CCAGCCCCCTTGTCCTTCCTGTG ATCATAGAAGTGGCATCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 428, 4: 1866} {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!