ID: 900826735_900826744

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 900826735 900826744
Species Human (GRCh38) Human (GRCh38)
Location 1:4933014-4933036 1:4933063-4933085
Sequence CCTTCCCCGTGTTTCTCAAGGGC TGAATCCATTCTCTCCTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!