ID: 900844070_900844076 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 900844070 | 900844076 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:5082179-5082201 | 1:5082218-5082240 |
| Sequence | CCTAACACCAATATTGGATCCTG | GCCCATTTGCTGCTGTTCTCAGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||