ID: 900865525_900865529

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900865525 900865529
Species Human (GRCh38) Human (GRCh38)
Location 1:5266194-5266216 1:5266218-5266240
Sequence CCAGAGTGGCGGAAGAGCTGTGG GTGTTAGGGATCCCGAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!