ID: 900949347_900949356

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900949347 900949356
Species Human (GRCh38) Human (GRCh38)
Location 1:5849201-5849223 1:5849236-5849258
Sequence CCACTGTTTCGGTCCAGGCCAGC AAGCCTCCCCTCACCATCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!