ID: 900953934_900953937

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 900953934 900953937
Species Human (GRCh38) Human (GRCh38)
Location 1:5875352-5875374 1:5875378-5875400
Sequence CCTATTCCTGAGAGACTCTTCAC CACGAGTCTGGCCCCCCGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165} {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!