ID: 900957643_900957645

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900957643 900957645
Species Human (GRCh38) Human (GRCh38)
Location 1:5897074-5897096 1:5897098-5897120
Sequence CCTGTCTTTGTGGAGCATGTATA GTAGTTCATCGCTTATCGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 175} {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!