ID: 900961789_900961790

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 900961789 900961790
Species Human (GRCh38) Human (GRCh38)
Location 1:5927051-5927073 1:5927075-5927097
Sequence CCAAGAGGCTCTGAGCACAGGGT CTGCCTCAGCAGAAGCAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 253} {0: 1, 1: 2, 2: 17, 3: 90, 4: 615}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!