ID: 900972074_900972081

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900972074 900972081
Species Human (GRCh38) Human (GRCh38)
Location 1:5997243-5997265 1:5997293-5997315
Sequence CCTTCTGCGTGGTTTCCTGGGAC CCTGCTGAGTGATTTCACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155} {0: 1, 1: 0, 2: 1, 3: 17, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!