ID: 900996586_900996594

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900996586 900996594
Species Human (GRCh38) Human (GRCh38)
Location 1:6126389-6126411 1:6126407-6126429
Sequence CCCTGACAGAATCCTGCCCCACC CCACCCTCCGCCTCTGGGTATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 13, 4: 214} {0: 1, 1: 2, 2: 1, 3: 17, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!