ID: 901014127_901014138

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 901014127 901014138
Species Human (GRCh38) Human (GRCh38)
Location 1:6218027-6218049 1:6218064-6218086
Sequence CCACACACCCTTCCCTCCCTCAG CCAGCACGCAGCTTCCATGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 121, 4: 1378} {0: 1, 1: 0, 2: 2, 3: 13, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!