ID: 901019477_901019483

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901019477 901019483
Species Human (GRCh38) Human (GRCh38)
Location 1:6248614-6248636 1:6248641-6248663
Sequence CCACACCAGGCCACATGCTGAAA ACCTCCACAAAGGCCGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 609} {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!