ID: 901022122_901022138

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 901022122 901022138
Species Human (GRCh38) Human (GRCh38)
Location 1:6260892-6260914 1:6260920-6260942
Sequence CCCCCGGGCCGAGCGCAGGCCGC GCCGCGGGGGTGGCTGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194} {0: 1, 1: 0, 2: 4, 3: 68, 4: 551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!