ID: 901026754_901026759

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 901026754 901026759
Species Human (GRCh38) Human (GRCh38)
Location 1:6282384-6282406 1:6282405-6282427
Sequence CCGGGGCAAGTGCTGCCCTGCGG GGTCAGAATGCCCTCCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 183} {0: 1, 1: 0, 2: 1, 3: 9, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!