ID: 901052000_901052003

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901052000 901052003
Species Human (GRCh38) Human (GRCh38)
Location 1:6429947-6429969 1:6429971-6429993
Sequence CCCACAGCAGCATGTGACTCGAC GATAAGAAGGTGTCTTTGTGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 84} {0: 1, 1: 1, 2: 0, 3: 16, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!