ID: 901054930_901054936

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 901054930 901054936
Species Human (GRCh38) Human (GRCh38)
Location 1:6444666-6444688 1:6444685-6444707
Sequence CCAGCACCCTCCATGTGGTGAGT GAGTGTGCCCAGGAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 15, 4: 178} {0: 3, 1: 1, 2: 4, 3: 41, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!