ID: 901061394_901061398

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 901061394 901061398
Species Human (GRCh38) Human (GRCh38)
Location 1:6473510-6473532 1:6473524-6473546
Sequence CCCCAGGGCGGGTTTCCAGGGCC TCCAGGGCCTCAGGCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 178} {0: 1, 1: 0, 2: 2, 3: 46, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!