ID: 901063224_901063234

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 901063224 901063234
Species Human (GRCh38) Human (GRCh38)
Location 1:6483310-6483332 1:6483351-6483373
Sequence CCTTGAGCACCAGGTGCCCCCAC TGATCTTCAACTGTGCTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 280} {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!