ID: 901068688_901068701

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 901068688 901068701
Species Human (GRCh38) Human (GRCh38)
Location 1:6506685-6506707 1:6506731-6506753
Sequence CCTGCCTGGACCCTCCCCAGGAA CACTGAGCCGAGGCCCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 379} {0: 1, 1: 0, 2: 2, 3: 8, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!