ID: 901071711_901071724

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 901071711 901071724
Species Human (GRCh38) Human (GRCh38)
Location 1:6523287-6523309 1:6523331-6523353
Sequence CCACTGCCACCAGCCGGGTGCGG ACACTTTGGGAGGCCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197} {0: 4504, 1: 70378, 2: 188418, 3: 232456, 4: 177655}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!