ID: 901088330_901088342

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 901088330 901088342
Species Human (GRCh38) Human (GRCh38)
Location 1:6625414-6625436 1:6625447-6625469
Sequence CCGAGGTCCTGGGCCCAGAGGGG CGCGCCCGCCGCGGGGATGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 42, 4: 490} {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!