ID: 901117869_901117877

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 901117869 901117877
Species Human (GRCh38) Human (GRCh38)
Location 1:6863302-6863324 1:6863328-6863350
Sequence CCTTTGACCACCATCTCCCCATT TCCCCAACCCCTGTGAGTTCAGG
Strand - +
Off-target summary {0: 2, 1: 135, 2: 522, 3: 1154, 4: 2077} {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!