ID: 901126161_901126167

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 901126161 901126167
Species Human (GRCh38) Human (GRCh38)
Location 1:6930288-6930310 1:6930310-6930332
Sequence CCATGTTCCCACCATTGTACACC CGTCATATGCTGAAGGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 130, 4: 2259} {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!