ID: 901153765_901153770

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901153765 901153770
Species Human (GRCh38) Human (GRCh38)
Location 1:7122067-7122089 1:7122090-7122112
Sequence CCGGGAAAGGCCATGGAGTGTTC TGGGCTCTGTGAGTGTCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 160} {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!