ID: 901157675_901157685

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901157675 901157685
Species Human (GRCh38) Human (GRCh38)
Location 1:7151389-7151411 1:7151416-7151438
Sequence CCTGGATTGCCCAGCGAGGCTGC CCCTTGGGTGTCTGTGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127} {0: 1, 1: 0, 2: 4, 3: 33, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!