ID: 901176302_901176307

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 901176302 901176307
Species Human (GRCh38) Human (GRCh38)
Location 1:7301918-7301940 1:7301952-7301974
Sequence CCCCTGTCATCCAGCACACGGAA TGAGACCAGAGCTGTGGCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175} {0: 1, 1: 0, 2: 6, 3: 31, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!