ID: 901177942_901177951

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901177942 901177951
Species Human (GRCh38) Human (GRCh38)
Location 1:7318289-7318311 1:7318320-7318342
Sequence CCCGTAAAGGCTTCCCTGGGGTA TTGGTCAGTGACTGGTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168} {0: 1, 1: 0, 2: 2, 3: 13, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!