ID: 901193324_901193330

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 901193324 901193330
Species Human (GRCh38) Human (GRCh38)
Location 1:7425504-7425526 1:7425536-7425558
Sequence CCTTCAGAGCAGCCTCCATGGCA AGAGTGTGAATGAGGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 39, 4: 260} {0: 1, 1: 0, 2: 1, 3: 20, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!