ID: 901196991_901196997

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901196991 901196997
Species Human (GRCh38) Human (GRCh38)
Location 1:7445763-7445785 1:7445794-7445816
Sequence CCTCTTCCTAAGCGATGAACATC CTGCTGCTACAGAGGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65} {0: 1, 1: 0, 2: 2, 3: 39, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!