|
Left Crispr |
Right Crispr |
| Crispr ID |
901227667 |
901227672 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:7623657-7623679
|
1:7623682-7623704
|
| Sequence |
CCCAGCTAATTCTGTATTTTCAG |
GAGATGGGATTTCACCATGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353} |
{0: 2428, 1: 46878, 2: 102336, 3: 132739, 4: 103586} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|