ID: 901227667_901227672

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901227667 901227672
Species Human (GRCh38) Human (GRCh38)
Location 1:7623657-7623679 1:7623682-7623704
Sequence CCCAGCTAATTCTGTATTTTCAG GAGATGGGATTTCACCATGTTGG
Strand - +
Off-target summary {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353} {0: 2428, 1: 46878, 2: 102336, 3: 132739, 4: 103586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!