ID: 901229346_901229354

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 901229346 901229354
Species Human (GRCh38) Human (GRCh38)
Location 1:7633361-7633383 1:7633405-7633427
Sequence CCTCAGAGAGGAAGAGCTGCAGA CCCCCAGATGCCACCCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 406} {0: 1, 1: 0, 2: 4, 3: 22, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!