ID: 901229346_901229356

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 901229346 901229356
Species Human (GRCh38) Human (GRCh38)
Location 1:7633361-7633383 1:7633406-7633428
Sequence CCTCAGAGAGGAAGAGCTGCAGA CCCCAGATGCCACCCCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 406} {0: 1, 1: 0, 2: 4, 3: 24, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!