ID: 901229583_901229598

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 901229583 901229598
Species Human (GRCh38) Human (GRCh38)
Location 1:7634347-7634369 1:7634392-7634414
Sequence CCAGACCTGGGCAGCTGTGGGAA GAGCAGGAGGTCGGGAGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 287} {0: 1, 1: 1, 2: 2, 3: 49, 4: 651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!