ID: 901243441_901243448

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 901243441 901243448
Species Human (GRCh38) Human (GRCh38)
Location 1:7709178-7709200 1:7709197-7709219
Sequence CCTCCCAGATTAGATTAACAGCT AGCTGTTTATGGGGTGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 358} {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!