ID: 901244171_901244180

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 901244171 901244180
Species Human (GRCh38) Human (GRCh38)
Location 1:7715590-7715612 1:7715632-7715654
Sequence CCAGCCACATCCCCCTTTCACAG TGCTTTTTTACGTAATCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 394, 4: 879} {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!