ID: 901290754_901290755

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901290754 901290755
Species Human (GRCh38) Human (GRCh38)
Location 1:8122449-8122471 1:8122480-8122502
Sequence CCTTATTTATTTAAAGGTTTGTT ACTAACAACCACATACCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 93, 4: 1230} {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!