ID: 901317302_901317311

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 901317302 901317311
Species Human (GRCh38) Human (GRCh38)
Location 1:8317921-8317943 1:8317959-8317981
Sequence CCTGGCAGATCCTGCAGACCGCG CACCGGGACGGGCCTCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94} {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!