ID: 901318886_901318895

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 901318886 901318895
Species Human (GRCh38) Human (GRCh38)
Location 1:8327363-8327385 1:8327408-8327430
Sequence CCACAGAGCCACTGCCATTAGGG GTCAGCCCCACTGGTCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 166} {0: 1, 1: 1, 2: 6, 3: 23, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!