ID: 901326762_901326767

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901326762 901326767
Species Human (GRCh38) Human (GRCh38)
Location 1:8371319-8371341 1:8371342-8371364
Sequence CCCAGCAGAGGTGTCTTTCCAGG CTATACACTAAGATGGAGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 197} {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!