ID: 901329404_901329411

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 901329404 901329411
Species Human (GRCh38) Human (GRCh38)
Location 1:8393496-8393518 1:8393534-8393556
Sequence CCTTTCCAAGTCCTGTTTAATTC GTTGGTTTTCTAACAGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254} {0: 1, 1: 0, 2: 2, 3: 10, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!