ID: 901336324_901336328

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 901336324 901336328
Species Human (GRCh38) Human (GRCh38)
Location 1:8452164-8452186 1:8452182-8452204
Sequence CCTCTACAGCACCCTTCCTGATC TGATCTCCCTGTCCAAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 149} {0: 1, 1: 1, 2: 1, 3: 6, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!