ID: 901361360_901361370

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 901361360 901361370
Species Human (GRCh38) Human (GRCh38)
Location 1:8703406-8703428 1:8703443-8703465
Sequence CCCAGACGCCGGGAGAGAAAGAG CGGCGGCGGCCGGCAAAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145} {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!